nanobody sequence (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
nanobody sequence
Nanobody Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ires+egfp+sequence/pCDNA3%2E0_nucNanobody+IRES+EGFP+(Plasmid+%23136619)/pmc12289307-20-3-6
Average 93 stars, based on 2 article reviews
Nanobody Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ires+egfp+sequence/pCDNA3%2E0_nucNanobody+IRES+EGFP+(Plasmid+%23136619)/pmc12289307-20-3-6
Average 93 stars, based on 2 article reviews
nanobody sequence - by Bioz Stars,
2026-10
93/100 stars
Images
1) Product Images from "Rapid and inducible mislocalization of endogenous TDP43 in a novel human model of amyotrophic lateral sclerosis"
Article Title: Rapid and inducible mislocalization of endogenous TDP43 in a novel human model of amyotrophic lateral sclerosis
Journal: eLife
doi: 10.7554/eLife.95062
Figure Legend Snippet: ( A ) Schematic depicting genome editing of healthy iPSCs to knock-in GFP into the C-terminus of endogenous TARDBP , encoding TDP43. Yellow rectangle indicates the TDP43 last exon. Red vertical line indicates the STOP codon. Blue rectangle indicates the TDP43 3’UTR. The resulting TDP43-GFP iPSCs are differentiated into motor neurons (MNs) and transduced with adeno-associated viruses (AAVs) encoding anti-GFP nanobodies. The ‘nuclear export signal (NES)’ nanobody includes a sequence for a strong nuclear export signal, which transports nuclear TDP43-GFP into the cytoplasm. The control nanobody (lacking NES) has no effect on TDP43-GFP localization. Panel created in BioRender . ( B ) Representative images depicting TDP43 localization in two homozygous TDP43-GFP lines ( E8, E5 ). MNs were transduced at day 20 of the differentiation process and fixed at day 40 for the immunostaining. TDP43 is expressed in the nucleus in the presence of the control nanobody and relocates to the cytoplasm in the presence of the NES nanobody. TDP43-GFP indicates signal from the anti-GFP antibody while TDP43 indicates signal from the anti-TDP43 antibody. Neurons were also stained with neurofilament-M (red) and Hoechst 33342 (blue nuclear stain). Scale bar = 50 µm. ( C ) Quantification of the % of nuclear TDP43 intensity over total TDP43 intensity in the nucleus + soma in individual neurons transduced with control or NES nanobodies. ( D ) Quantification of morphological defects and cleaved caspase 3 (CC3) levels in NES nanobody-treated MNs versus control. Mislocalized TDP43 (NES) causes a reduction in dendritic complexity ( D ), soma swelling, and elevation of CC3 levels, compared to neurons expressing nuclear TDP43 (control). Low-to-moderate mislocalization indicates neurons with >40% nuclear TDP43. Severe mislocalization indicates neurons with <40% nuclear TDP43. Measurements were normalized to data from the control nanobody condition. Panels C and D display data for the two homozygous TDP43-GFP lines ( E8 and E5 ), transduced with nanobodies at day 20 and fixed for staining at day 40. N=3 independent differentiations per clone. At least 100 neurons were included per condition. ( E ) Representative images showing cytoplasmic TDP43 puncta at day 40 in homozygous TDP43-GFP MNs transduced with the NES nanobody at day 18. Scale bar = 15 µm. Images were captured with the Zeiss LSM880 Airyscan. ( F ) Quantification of the percentage of NES-expressing neurons displaying TDP43 puncta. The largest punctum per neuron was used for the analysis. Upper panel shows data for E8 neurons, while lower panel displays data for E5 neurons. N=3 independent differentiations per clone. At least 100 neurons were included per clone for the analysis. * indicates p<0.01, ** indicates p<0.001, *** indicates p<0.0001. Figure 1—source code 1. R script to analyse CC3 intensities for clone E5 motor neuron (MN). Figure 1—source code 2. R script to analyse CC3 intensities for clone E8 motor neuron (MN). Figure 1—source code 3. R script to analyse dendritic complexity for clone E5 motor neuron (MN). Figure 1—source code 4. R script to analyse dendritic complexity for clone E8 motor neuron (MN).
Techniques Used: Knock-In, Transduction, Sequencing, Control, Immunostaining, Staining, Expressing
Figure Legend Snippet: ( A ) Related to main . Quantification of morphological defects in nuclear export signal (NES) nanobody-treated motor neuron s (MNs) versus control. Mislocalized TDP43 (NES) causes a reduction in dendritic complexity ( D ) and soma swelling, compared to neurons expressing nuclear TDP43 (control). ( B ) Related to main . Quantification of caspase 3 (CC3) levels in NES nanobody-treated MNs versus control. Mislocalized TDP43 (NES) causes elevation of CC3 levels, compared to neurons expressing nuclear TDP43 (control). For A and B, each replicate is indicated by a different colour. Control: control nanobody, NES: NES nanobody, NES-M: Low to moderate levels of mislocalization, defined as neurons with >60% nuclear TDP43. NES-S: Severe mislocalization is defined as neurons with <60% nuclear TDP43. ( C ) Morphological analysis in unedited (parent) induced pluripotent stem cell (iPSC) MNs treated with control or NES nanobodies. No significant effect is observed on dendrite morphology, soma swelling, or apoptosis (CC3 intensity) at a p-value threshold of 0.01. N=2 independent differentiations. At least 150 neurons were analysed per condition. CC3=cleaved caspase-3. Each replicate is indicated by a different colour. ( D ) RT-qPCR showing abnormal splicing of UNC13A and STMN2 in day 40 homozygous TDP43-GFP MNs, 20 days post-transduction with NES or control nanobodies. N=6 replicates of NES and CTRL each (three of E5, three of E8). Error bars show SEM. CE = cryptic exon, TRUNC = truncated. n.s.=not significant, ** indicates p<0.01, *** indicates p<0.001. Figure 1—figure supplement 2—source data 1. CC3 intensities per soma for clone E5 MN. Figure 1—figure supplement 2—source data 2. Neurite complexity per soma for clone E5 MN. Figure 1—figure supplement 2—source data 3. CC3 intensities per soma for clone E8 MN. Figure 1—figure supplement 2—source data 4. Neurite complexity per soma for clone E5 MN.
Techniques Used: Control, Expressing, Quantitative RT-PCR, Transduction
Figure Legend Snippet: ( A ) STMN2 transcripts containing the cryptic exo (CE) in the TDP43-GFP motor neurons (MNs) expressing the nuclear export signal (NES) nanobody (isoforms containing the variable length CE are shown in red, reference isoforms are shown in dark blue at the top). Each isoform was assigned a unique number. Top five most abundant isoforms are marked by yellow arrows. Isoforms containing the extra 114 bp exon upstream of the CE are marked by purple arrows. ( B ) Quantification of the top five most abundant STMN2 isoforms in TDP43-GFP MNs expressing control or NES nanobody. Each dot represents data from an independent replicate. N=4.
Techniques Used: Expressing, Control
Figure Legend Snippet: ( A ) Schematic depicting the knock-in of the nanobody (control or nuclear export signal , NES) into the human AAVS1 safe harbour locus of our E8 homozygous TDP43-GFP cell line. Nanobody expression was under the control of a doxycycline (Dox)-inducible promoter. Addition of Dox is expected to induce TDP43 mislocalization in the TDP43-GFP-NES motor neurons (MNs) but not in the TDP43-GFP-Control (TDP43-GFP-CTRL) MNs. Panel created in BioRender . ( B ) Immunofluorescent staining showing TDP43 localization in our TDP43-GFP-CTRL or TDP43-GFP-NES line in response to Dox. Mislocalization only occurs in the TDP43-GFP-NES line with Dox treatment, while all other conditions maintain nuclear TDP43. MNs were fixed and stained at day 35, 15 days post-Dox addition. Scale bar = 50 µm. ( C ) TDP43 localization in the TDP43-GFP-NES or –CTRL cell lines at day 40, 20 days post-Dox addition. The box highlights cytoplasmic TDP43 puncta in the NES line. Scale bar = 20 µm. ( D ) Western blots of total and phosphorylated TDP43 in TDP43-GFP-NES or –CTRL cell lines at day 40, 20 days post-Dox addition. Alpha-tubulin was used as a loading control. ( E ) Quantification of total and phosphorylated TDP43-GFP from Figure D. Total TDP43-GFP remains stable, while there is a significant increase in phosphorylated TDP43-GFP in the NES lines. Each sample was normalized to alpha-tubulin, pTDP43 samples were also normalized to total TDP43 levels. Replicates are three independent differentiations of TDP43-GFP-NES or –CTRL. pTDP43-GFP=phosphorylated TDP43-GFP. * indicates p<0.05. Error bars indicate SEM. Figure 3—source data 1. PDF of labelled uncropped western blots shown in . Figure 3—source data 2. unedited original files for western blots shown in .
Techniques Used: Knock-In, Control, Expressing, Staining, Western Blot
Figure Legend Snippet: ( A ) Principal component analysis (PCA) plot using the top 500 most variable genes. Control: motor neurons (MNs) expressing the control nanobody, nuclear export signal (NES): MNs expressing the NES nanobody. ( B ) GO enrichment analysis of 494 genes mis-spliced in the NES MNs compared to Control MNs. Splicing changes were detected using leafcutter at an adjusted p-value <0.01 and delta-Psi >0.1. Figure 3—figure supplement 3—source code 1. R script to analyse differential gene expression data for . Figure 3—figure supplement 3—source code 2. R script to analyse splicing changes for . Figure 3—figure supplement 3—source data 1. Leafcutter analysis to analyse splicing changes due to TDP43 mislocalisation related to . Figure 3—figure supplement 3—source data 2. Leafcutter analysis to analyse splicing changes due to TDP43 mislocalisation related to . Figure 3—figure supplement 3—source data 3. DESeq2 output related to . Figure 3—figure supplement 3—source data 4. Sample details related to RNA-seq analysis shown in .
Techniques Used: Control, Expressing, Gene Expression, RNA Sequencing
Figure Legend Snippet: ( A ) TDP43 localization in the E8 TDP43-GFP motor neurons (MNs) expressing Dox-inducible V5-tagged nanobodies. Control: control-V5 nanobody. NES: NES-V5 nanobody. Constant: neurons were treated with Dox continuously. Removed: Dox was withdrawn five days after its addition. N=2 for the constant +control condition. N=4 for the nuclear export signal (NES) conditions. Each replicate is indicated by a coloured dot. ( B, C ) Representative images of the TDP43-GFP MNs expressing NES-V5 nanobody under constant Dox treatment ( B ) and 21 days post-Dox withdrawal ( C ). Boxes indicate the Pearson correlation coefficient between the TDP43-GFP and V5-nanobody signals across individual pixels within the soma. A higher coefficient indicates higher co-localization. Scale bar = 10 µm. Images were captured with the Zeiss LSM880 Airyscan.
Techniques Used: Expressing, Control
Related Articles
Sequencing:Article Title: Protocol for CRISPR-mediated deletion of cis -regulatory element in murine Th17 cells for in vivo assessment of effector function Article Snippet: .. Design primers for amplifying the PGK promoter and BFP to generate the MIGR1-PGK-BFP vector, replacing the Article Title: T-cadherin modulates adipogenic differentiation in mesenchymal stem cells: insights into ligand interactions Article Snippet: .. Vlasik, at the Federal State Budgetary Institution National Medical Research Center of Cardiology of the Ministry of Health of the Russian Federation) using the primer pair hTcad-dir (GTC CTC CGA TTG ACT GAG TCG CCC GGA TCC CCC GGA CAA AAT GCA GC) and hTcad-rev (CGG ATC CCA ATT CGA TAT CAA GCT GGT TCA CAG ACA AGC TAA GCT GAA GAG GC); Article Title: Protocol for CRISPR-mediated deletion of cis-regulatory element in murine Th17 cells for in vivo assessment of effector function. Article Snippet: .. Design primers for amplifying the PGK promoter and BFP to generate the MIGR1-PGK-BFP vector, replacing the Article Title: T-cadherin modulates adipogenic differentiation in mesenchymal stem cells: insights into ligand interactions Article Snippet: To generate the LV-LeGO-hTcad-IRES-eGFP plasmid, hTcadherin gene was amplified from pCWP1-hTcad plasmid encoding human T-cadherin cDNA (a kind gift from the Laboratory of Cellular Engineering led by T.N. .. Vlasik, at the Federal State Budgetary Institution National Medical Research Center of Cardiology of the Ministry of Health of the Russian Federation) using the primer pair hTcad-dir (GTCCTCCGATTG ACTGAGTCGCCCGGATCCCCCGGACAAAATGCAGC) and hTcad-rev (CGGATCCCAATTCGATATCAAGCTGGTTCACAG ACAAGCTAAGCTGAAGAGGC); Article Title: Dissecting the early steps of MLL induced leukaemogenic transformation using a mouse model of AML Article Snippet: .. Countercurrent Chromatography:Article Title: T-cadherin modulates adipogenic differentiation in mesenchymal stem cells: insights into ligand interactions Article Snippet: .. Vlasik, at the Federal State Budgetary Institution National Medical Research Center of Cardiology of the Ministry of Health of the Russian Federation) using the primer pair hTcad-dir (GTC CTC CGA TTG ACT GAG TCG CCC GGA TCC CCC GGA CAA AAT GCA GC) and hTcad-rev (CGG ATC CCA ATT CGA TAT CAA GCT GGT TCA CAG ACA AGC TAA GCT GAA GAG GC); Amplification:Article Title: T-cadherin modulates adipogenic differentiation in mesenchymal stem cells: insights into ligand interactions Article Snippet: .. Vlasik, at the Federal State Budgetary Institution National Medical Research Center of Cardiology of the Ministry of Health of the Russian Federation) using the primer pair hTcad-dir (GTC CTC CGA TTG ACT GAG TCG CCC GGA TCC CCC GGA CAA AAT GCA GC) and hTcad-rev (CGG ATC CCA ATT CGA TAT CAA GCT GGT TCA CAG ACA AGC TAA GCT GAA GAG GC); Article Title: T-cadherin modulates adipogenic differentiation in mesenchymal stem cells: insights into ligand interactions Article Snippet: To generate the LV-LeGO-hTcad-IRES-eGFP plasmid, hTcadherin gene was amplified from pCWP1-hTcad plasmid encoding human T-cadherin cDNA (a kind gift from the Laboratory of Cellular Engineering led by T.N. .. Vlasik, at the Federal State Budgetary Institution National Medical Research Center of Cardiology of the Ministry of Health of the Russian Federation) using the primer pair hTcad-dir (GTCCTCCGATTG ACTGAGTCGCCCGGATCCCCCGGACAAAATGCAGC) and hTcad-rev (CGGATCCCAATTCGATATCAAGCTGGTTCACAG ACAAGCTAAGCTGAAGAGGC); Article Title: Dissecting the early steps of MLL induced leukaemogenic transformation using a mouse model of AML Article Snippet: .. Plasmid Preparation:Article Title: T-cadherin modulates adipogenic differentiation in mesenchymal stem cells: insights into ligand interactions Article Snippet: .. Vlasik, at the Federal State Budgetary Institution National Medical Research Center of Cardiology of the Ministry of Health of the Russian Federation) using the primer pair hTcad-dir (GTC CTC CGA TTG ACT GAG TCG CCC GGA TCC CCC GGA CAA AAT GCA GC) and hTcad-rev (CGG ATC CCA ATT CGA TAT CAA GCT GGT TCA CAG ACA AGC TAA GCT GAA GAG GC); Article Title: T-cadherin modulates adipogenic differentiation in mesenchymal stem cells: insights into ligand interactions Article Snippet: To generate the LV-LeGO-hTcad-IRES-eGFP plasmid, hTcadherin gene was amplified from pCWP1-hTcad plasmid encoding human T-cadherin cDNA (a kind gift from the Laboratory of Cellular Engineering led by T.N. .. Vlasik, at the Federal State Budgetary Institution National Medical Research Center of Cardiology of the Ministry of Health of the Russian Federation) using the primer pair hTcad-dir (GTCCTCCGATTG ACTGAGTCGCCCGGATCCCCCGGACAAAATGCAGC) and hTcad-rev (CGGATCCCAATTCGATATCAAGCTGGTTCACAG ACAAGCTAAGCTGAAGAGGC); Article Title: Dissecting the early steps of MLL induced leukaemogenic transformation using a mouse model of AML Article Snippet: .. other:Article Title: A Novel Mgp -Cre Knock-In Mouse Reveals an Anticalcification/Antistiffness Candidate Gene in the Trabecular Meshwork and Peripapillary Scleral Region Article Snippet: The following steps were conducted to produce the Mgp- IRES-Cre-FRP-flanked PGK-Neo targeting vector: (1) An Polymerase Chain Reaction:Article Title: Dissecting the early steps of MLL induced leukaemogenic transformation using a mouse model of AML Article Snippet: .. Clone Assay:Article Title: Dissecting the early steps of MLL induced leukaemogenic transformation using a mouse model of AML Article Snippet: .. |